Namefru-let-7b
AccessionMIMAT0003016
SpeciesFugu rubripes
Precursorsfru-let-7b
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]