Namefru-let-7h
AccessionMIMAT0002892
SpeciesFugu rubripes
Precursorsfru-let-7h
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAAGUUGUGUUGUU

Seed family - other species [214]

Landgraf expression levels [0]

M2d disease links [0]