Namegga-let-7a
AccessionMIMAT0001101
SpeciesGallus gallus
Precursorsgga-let-7a-3, gga-let-7a-1, gga-let-7a-2
Descriptionexperimental
Experimentcloned (McBride D , Yao Y 2008)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]