Namegga-let-7c
AccessionMIMAT0001104
SpeciesGallus gallus
Precursorsgga-let-7c
Descriptionexperimental
Experimentcloned (McBride D )
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]