Namegga-let-7d
AccessionMIMAT0001161
SpeciesGallus gallus
Precursorsgga-let-7d
Descriptionnot_experimental
Experiment
Sequence
AGAGGUAGUGGGUUGCAUAGU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]