Namegga-let-7f
AccessionMIMAT0001162
SpeciesGallus gallus
Precursorsgga-let-7f
Descriptionexperimental
Experimentcloned (McBride D )
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]