Namegga-let-7i
AccessionMIMAT0001098
SpeciesGallus gallus
Precursorsgga-let-7i
Descriptionexperimental
Experimentcloned (McBride D , Yao Y 2008)
Sequence
UGAGGUAGUAGUUUGUGCUGU

Seed family - other species [213]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]