Namegga-let-7j
AccessionMIMAT0001181
SpeciesGallus gallus
Precursorsgga-let-7j
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]