Namegga-let-7k
AccessionMIMAT0001182
SpeciesGallus gallus
Precursorsgga-let-7k
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGAUUGAAUAGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]