Nameggo-miR-98
AccessionMIMAT0002406
SpeciesGorilla gorilla
Precursorsggo-mir-98
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family [1]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]