Namehsa-let-7a
AccessionMIMAT0000062
SpeciesHomo sapiens
Precursorshsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3
Descriptionexperimental
Experimentcloned (Lagos-Quintana M 2001, Suh MR 2004, Dostie J 2003, Kasashima K 2004, Landgraf P 2007, Lui WO 2007, Marton S 2008), Northern (Lagos-Quintana M 2001), Solexa (Koh W 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [211]

Papers [9]

Landgraf expression levels [172]

M2d disease links [33]