Namehsa-let-7e
AccessionMIMAT0000066
SpeciesHomo sapiens
Precursorshsa-let-7e
Descriptionexperimental
Experimentcloned (Lagos-Quintana M 2001, Kasashima K 2004, Landgraf P 2007, Lui WO 2007), Northern (Lagos-Quintana M 2001), Solexa (Koh W 2010)
Sequence
UGAGGUAGGAGGUUGUAUAGUU

Seed family - other species [211]

Papers [5]

Landgraf expression levels [172]

M2d disease links [14]