Namehsa-let-7f
AccessionMIMAT0000067
SpeciesHomo sapiens
Precursorshsa-let-7f-1, hsa-let-7f-2
Descriptionexperimental
Experimentcloned (Lagos-Quintana M 2001, Kasashima K 2004, Landgraf P 2007, Lui WO 2007), Northern (Lagos-Quintana M 2001), Solexa (Koh W 2010)
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [211]

Papers [6]

Landgraf expression levels [172]

M2d disease links [12]