Namehsa-let-7g
AccessionMIMAT0000414
SpeciesHomo sapiens
Precursorshsa-let-7g
Descriptionexperimental
Experimentcloned (Landgraf P 2007, Lui WO 2007), Solexa (Koh W 2010)
Sequence
UGAGGUAGUAGUUUGUACAGUU

Seed family - other species [211]

Papers [4]

Landgraf expression levels [172]

M2d disease links [11]