Namehsa-let-7i
AccessionMIMAT0000415
SpeciesHomo sapiens
Precursorshsa-let-7i
Descriptionexperimental
Experimentcloned (Landgraf P 2007, Lui WO 2007), Solexa (Koh W 2010)
Sequence
UGAGGUAGUAGUUUGUGCUGUU

Seed family - other species [211]

Papers [5]

Landgraf expression levels [172]

M2d disease links [4]