Namehsa-miR-196a
AccessionMIMAT0000226
SpeciesHomo sapiens
Precursorshsa-mir-196a-1, hsa-mir-196a-2
Descriptionexperimental
Experimentcloned (Lagos-Quintana M 2003, Landgraf P 2007, Lui WO 2007)
Sequence
UAGGUAGUUUCAUGUUGUUGGG

Seed family - other species [42]

Papers [5]

Landgraf expression levels [172]

M2d disease links [4]