Namehsa-miR-196b
AccessionMIMAT0001080
SpeciesHomo sapiens
Precursorshsa-mir-196b
Descriptionexperimental
Experimentcloned (Landgraf P 2007, Lui WO 2007)
Sequence
UAGGUAGUUUCCUGUUGUUGGG

Seed family - other species [42]

Papers [4]

Landgraf expression levels [172]

M2d disease links [3]