Namehsa-miR-202
AccessionMIMAT0002811
SpeciesHomo sapiens
Precursorshsa-mir-202
Descriptionexperimental
Experimentcloned (Landgraf P 2007)
Sequence
AGAGGUAUAGGGCAUGGGAA

Seed family - other species [5]

Papers [2]

Landgraf expression levels [172]

M2d disease links [1]