Namehsa-miR-3927
AccessionMIMAT0018202
SpeciesHomo sapiens
Precursorshsa-mir-3927
Descriptionexperimental
ExperimentSolexa (Creighton CJ 2010)
Sequence
CAGGUAGAUAUUUGAUAGGCAU

Seed family - other species [6]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]