Namehsa-miR-98
AccessionMIMAT0000096
SpeciesHomo sapiens
Precursorshsa-mir-98
Descriptionexperimental
Experimentcloned (Mourelatos Z 2002, Landgraf P 2007, Lui WO 2007)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [211]

Papers [3]

Landgraf expression levels [172]

M2d disease links [2]