Namemdo-let-7a
AccessionMIMAT0004141
SpeciesMonodelphis domestica
Precursorsmdo-let-7a-2, mdo-let-7a-3, mdo-let-7a-1
Descriptionexperimental
ExperimentMicroarray (Devor EJ 2008), PCR (Devor EJ 2008)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]