Namemdo-let-7b
AccessionMIMAT0004162
SpeciesMonodelphis domestica
Precursorsmdo-let-7b
Descriptionexperimental
ExperimentMicroarray (Devor EJ 2008), PCR (Devor EJ 2008)
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]