Namemdo-let-7d
AccessionMIMAT0004172
SpeciesMonodelphis domestica
Precursorsmdo-let-7d
Descriptionexperimental
ExperimentPCR (Devor EJ 2008)
Sequence
AGAGGUAGUAGGUUGCAUAGU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]