Namemdo-let-7f
AccessionMIMAT0004161
SpeciesMonodelphis domestica
Precursorsmdo-let-7f-2, mdo-let-7f-1
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]