Namemdo-let-7i
AccessionMIMAT0004143
SpeciesMonodelphis domestica
Precursorsmdo-let-7i
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGUUUGUGCUGU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]