Namemml-let-7a
AccessionMIMAT0006151
SpeciesMacaca mulatta
Precursorsmml-let-7a-1, mml-let-7a-2, mml-let-7a-3
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]