Namemml-let-7b
AccessionMIMAT0006152
SpeciesMacaca mulatta
Precursorsmml-let-7b
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]