Namemml-let-7f
AccessionMIMAT0006156
SpeciesMacaca mulatta
Precursorsmml-let-7f-1, mml-let-7f-2
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]