Namemml-let-7g
AccessionMIMAT0006157
SpeciesMacaca mulatta
Precursorsmml-let-7g
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGUUUGUACAGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]