Namemml-miR-98
AccessionMIMAT0002404
SpeciesMacaca mulatta
Precursorsmml-mir-98
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]