Namemmu-let-7f
AccessionMIMAT0000525
SpeciesMus musculus
Precursorsmmu-let-7f-1, mmu-let-7f-2
Descriptionexperimental
Experimentcloned (Lagos-Quintana M 2002, Poy MN 2004, Watanabe T 2006, Landgraf P 2007), Solexa (Ahn HW 2010, Chiang HR 2010)
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [212]

Papers [6]

Landgraf expression levels [68]

M2d disease links [0]