Namemmu-miR-98
AccessionMIMAT0000545
SpeciesMus musculus
Precursorsmmu-mir-98
Descriptionexperimental
Experimentcloned (Landgraf P 2007), Solexa (Ahn HW 2010, Chiang HR 2010)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [212]

Papers [4]

Landgraf expression levels [68]

M2d disease links [0]