Namenvi-let-7
AccessionMIMAT0015678
SpeciesNasonia vitripennis
Precursorsnvi-let-7
Descriptionexperimental
Experiment454 (Werren JH 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]