Nameoan-let-7d
AccessionMIMAT0007234
SpeciesOrnithorhynchus anatinus
Precursorsoan-let-7d
Descriptionexperimental
ExperimentSolexa (Murchison EP 2008)
Sequence
AGAGGUAGUAGGUUGCAUAGUU

Seed family - other species [216]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]