Nameoan-let-7g
AccessionMIMAT0007038
SpeciesOrnithorhynchus anatinus
Precursorsoan-let-7g
Descriptionexperimental
ExperimentSolexa (Murchison EP 2008)
Sequence
UGAGGUAGUAGUUUGUACAGUU

Seed family - other species [216]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]