Nameodi-let-7b
AccessionMIMAT0006075
SpeciesOikopleura dioica
Precursorsodi-let-7b
Descriptionexperimental
Experimentcloned (Fu X 2008)
Sequence
UGAGGUAGUGGUUGUAAUAGCU

Seed family [3]

Seed family - other species [219]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]