Namepma-let-7a
AccessionMIMAT0019564
SpeciesPetromyzon marinus
Precursorspma-let-7a-1, pma-let-7a-2, pma-let-7a-3, pma-let-7a-4
Descriptionexperimental
Experiment454 (Heimberg AM 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [5]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]