Namepma-let-7b
AccessionMIMAT0019565
SpeciesPetromyzon marinus
Precursorspma-let-7b
Descriptionexperimental
Experiment454 (Heimberg AM 2010)
Sequence
UGAGGUAGUAGGUUUUGUAGUU

Seed family [5]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]