Nameppc-let-7
AccessionMIMAT0011657
SpeciesPristionchus pacificus
Precursorsppc-let-7
Descriptionexperimental
Experiment454 (de Wit E 2009)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [2]

Seed family - other species [219]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]