Nameppc-miR-84b
AccessionMIMAT0011653
SpeciesPristionchus pacificus
Precursorsppc-mir-84b
Descriptionexperimental
Experiment454 (de Wit E 2009)
Sequence
UGAGGUAGUUAAGAAUAUGUG

Seed family [2]

Seed family - other species [219]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]