Nameppy-let-7a
AccessionMIMAT0015721
SpeciesPongo pygmaeus
Precursorsppy-let-7a-1, ppy-let-7a-2, ppy-let-7a-3
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]