Nameppy-let-7c
AccessionMIMAT0015723
SpeciesPongo pygmaeus
Precursorsppy-let-7c
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]