Nameppy-let-7f
AccessionMIMAT0015726
SpeciesPongo pygmaeus
Precursorsppy-let-7f-1, ppy-let-7f-2
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]