Nameptr-let-7a
AccessionMIMAT0007936
SpeciesPan troglodytes
Precursorsptr-let-7a-1, ptr-let-7a-2, ptr-let-7a-3
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]