Nameptr-let-7b
AccessionMIMAT0007937
SpeciesPan troglodytes
Precursorsptr-let-7b
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]