Nameptr-let-7d
AccessionMIMAT0007939
SpeciesPan troglodytes
Precursorsptr-let-7d
Descriptionnot_experimental
Experiment
Sequence
AGAGGUAGUAGGUUGCAUAGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]