Nameptr-let-7f
AccessionMIMAT0007941
SpeciesPan troglodytes
Precursorsptr-let-7f-1, ptr-let-7f-2
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [213]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]