Namerno-let-7c
AccessionMIMAT0000776
SpeciesRattus norvegicus
Precursorsrno-let-7c-1, rno-let-7c-2
Descriptionexperimental
Experimentcloned (Kim J 2004, Miska EA 2004, Watanabe T 2006, Landgraf P 2007, He X 2007), SOLiD (Linsen SE 2010)
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [214]

Papers [6]

Landgraf expression levels [16]

M2d disease links [0]