Namerno-let-7e
AccessionMIMAT0000777
SpeciesRattus norvegicus
Precursorsrno-let-7e
Descriptionexperimental
Experimentcloned (Kim J 2004, Watanabe T 2006, Landgraf P 2007), SOLiD (Linsen SE 2010)
Sequence
UGAGGUAGGAGGUUGUAUAGUU

Seed family - other species [214]

Papers [4]

Landgraf expression levels [16]

M2d disease links [0]