Namesja-let-7
AccessionMIMAT0010175
SpeciesSchistosoma japonicum
Precursorssja-let-7
Descriptionexperimental
Experimentcloned (Xue X 2008), Solexa (Wang Z 2010)
Sequence
GGAGGUAGUUCGUUGUGUGGU

Seed family [0]

Seed family - other species [221]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]